Quantification of Urine and Plasma Porphyrin Precursors Using LC-MS in Acute Hepatic Porphyrias: Improvement in Routine Diagnosis and in the Monitoring of Kidney Failure Patients.

BACKGROUND: The quantification of delta-aminolevulinic acid (ALA) and porphobilinogen (PBG) in urine are the first-line tests for diagnosis and monitoring of acute hepatic porphyrias (AHP). Ion-exchange chromatography (IEC), which is time- and staff-consuming and limited to urine, is still the preferred method in many specialized laboratories, despite the development of mass spectrometry-based methods. METHODS: We describe a new LC-MS method that allows for rapid and simple quantification of ALA and PBG in urine and plasma with an affordable instrument that was used to analyze 2260 urine samples and 309 blood samples collected in 2 years of routine activity. The results were compared to those obtained with IEC, and urine reference ranges and concentrations in asymptomatic carriers were determined. Plasma concentrations were measured in healthy subjects and subgroups of symptomatic and asymptomatic AHP carriers. RESULTS: In urine, the clinical decision limits were not impacted by the change of method despite discrepancies in low absolute concentrations, leading to lower normal values. Two-thirds of asymptomatic AHP carriers (with the exception of coproporphyria carriers) showed an increased urine PBG concentration. Urine and plasma levels showed a good correlation except in patients with kidney disease in whom the urine/plasma ratio was relatively low. CONCLUSION: We described an LC-MS based method for the routine diagnosis and monitoring of AHP that allows for the detection of more asymptomatic carriers than the historical method. Blood analysis appears to be particularly relevant for patients with kidney disease, where urine measurement underestimates the increase in ALA and PBG levels.

Porphyrin precursors and risk of primary liver cancer in acute intermittent porphyria: A case-control study of 188 patients.

Acute intermittent porphyria (AIP) is a rare hereditary metabolic disease characterized by acute attacks and accumulation of the porphyrin precursors 5-aminolevulinic acid (ALA) and porphobilinogen (PBG). Patients with AIP have a high risk of primary liver cancer (PLC). We aimed to assess the association between porphyrin precursor excretion and the risk for PLC in patients with AIP. We studied 48 patients with AIP who developed PLC between 1987 and 2015 and 140 age and sex matched controls with AIP but no PLC. Data on all available urinary PBG and ALA samples collected from 1975 until 1 year before PLC diagnosis were analyzed and compared between cases and controls using logistic regression. Porphyrin precursor excretion was higher in patients with PLC (PBG median 7.9 [IQR 4.4-21.9] mmol/mol creatinine) than in controls (3.8 [1.2-9.8]) (adjusted odds ratio 1.07, 95% confidence interval: 1.02-1.12). None of the 28 patients with all registered samples below the upper limit of normal (ULN) developed PLC, and only one of the 45 patients with all samples <2× ULN developed PLC. Among non-PLC controls, ALA and PBG levels decreased after age 50-60 while an increasing trend was observed after age 65 among those who developed PLC. Increased urinary porphyrin precursors are associated with a high risk of developing PLC. Patients with normal levels appear to have a low risk while high or increasing ALA and PBG after age 65 indicates high risk, which should be considered in surveillance decisions.

AGA Clinical Practice Update on Diagnosis and Management of Acute Hepatic Porphyrias: Expert Review.

DESCRIPTION: The acute hepatic porphyrias (AHP) are rare, inborn errors of heme-metabolism and include acute intermittent porphyria, hereditary coproporphyria, variegate porphyria, and porphyria due to severe deficiency of 5-aminolevulinic acid dehydratase. Acute intermittent porphyria is the most common type of AHP, with an estimated prevalence of patients with symptoms of approximately 1 in 100,000. The major clinical presentation involves attacks of severe pain, usually abdominal and generalized, without peritoneal signs or abnormalities on cross-sectional imaging. Acute attacks occur mainly in women in their childbearing years. AHP should be considered in the evaluation of all patients, and especially women aged 15-50 years with recurrent severe abdominal pain not ascribable to common causes. The screening tests of choice include random urine porphobilinogen and δ-aminolevulinic acid corrected to creatinine. All patients with elevations in urinary porphobilinogen and/or δ-aminolevulinic acid should initially be presumed to have AHP. The cornerstones of management include discontinuation of porphyrinogenic drugs and chemicals, administration of oral or intravenous dextrose and intravenous hemin, and use of analgesics and antiemetics. Diagnosis of AHP type can be confirmed after initial treatment by genetic testing for pathogenic variants in HMBS, CPOX, PPOX, and ALAD genes. AHP is also associated with chronic symptoms and long-term risk of systemic arterial hypertension, chronic renal and liver disease, and hepatocellular carcinoma. Patients who have recurrent acute attacks (4 or more per year) should be considered for prophylactic therapy with intravenous hemin or subcutaneous givosiran. Liver transplantation is curative and reserved for patients with intractable symptoms who have failed other treatment options. METHODS: This expert review was commissioned and approved by the American Gastroenterological Association (AGA) Institute Clinical Practice Updates Committee (CPUC) and the AGA Governing Board to provide timely guidance on a topic of high clinical importance to the AGA membership, and underwent internal peer review by the CPUC and external peer review through standard procedures of Gastroenterology. These Best Practice Advice (BPA) statements were drawn from a review of the published literature and from expert opinion. Because systematic reviews were not performed, these BPA statements do not carry formal ratings of the quality of evidence or strength of the presented considerations. Best Practice Advice Statements BEST PRACTICE ADVICE 1: Women aged 15-50 years with unexplained, recurrent severe abdominal pain without a clear etiology after an initial workup should be considered for screening for an AHP. BEST PRACTICE ADVICE 2: Initial diagnosis of AHP should be made by biochemical testing measuring δ-aminolevulinic acid, porphobilinogen, and creatinine on a random urine sample. BEST PRACTICE ADVICE 3: Genetic testing should be used to confirm the diagnosis of AHP in patients with positive biochemical testing. BEST PRACTICE ADVICE 4: Acute attacks of AHP that are severe enough to require hospital admission should be treated with intravenous hemin, given daily, preferably into a high-flow central vein. BEST PRACTICE ADVICE 5: In addition to intravenous hemin, management of acute attacks of AHP should include pain control, antiemetics, management of systemic arterial hypertension, tachycardia, and hyponatremia, and hypomagnesemia, if present. BEST PRACTICE ADVICE 6: Patients should be counseled to avoid identifiable triggers that may precipitate acute attacks, such as alcohol and porphyrinogenic medications. BEST PRACTICE ADVICE 7: Prophylactic heme therapy or givosiran, administered in an outpatient setting, should be considered in patients with recurrent attacks (4 or more per year). BEST PRACTICE ADVICE 8: Liver transplantation for AHP should be limited to patients with intractable symptoms and significantly decreased quality of life who are refractory to pharmacotherapy. BEST PRACTICE ADVICE 9: Patients with AHP should be monitored annually for liver disease. BEST PRACTICE ADVICE 10: Patients with AHP, regardless of the severity of symptoms, should undergo surveillance for hepatocellular carcinoma, beginning at age 50 years, with liver ultrasound every 6 months. BEST PRACTICE ADVICE 11: Patients with AHP on treatment should undergo surveillance for chronic kidney disease annually with serum creatinine and estimated glomerular filtration rate. BEST PRACTICE ADVICE 12: Patients should be counseled on the chronic and long-term complications of AHP, including neuropathy, chronic kidney disease, hypertension, and hepatocellular carcinoma, and need for long-term monitoring.

Understanding Carbohydrate Metabolism and Insulin Resistance in Acute Intermittent Porphyria.

Porphobilinogen deaminase (PBGD) haploinsufficiency (acute intermittent porphyria, AIP) is characterized by neurovisceral attacks associated with high production, accumulation and urinary excretion of heme precursors, δ-aminolevulinic acid (ALA) and porphobilinogen (PBG). The estimated clinical penetrance for AIP is extremely low (<1%), therefore it is likely that other factors may play an important role in the predisposition to developing attacks. Fasting is a known triggering factor. Given the increased prevalence of insulin resistance in patients and the large urinary loss of succinyl-CoA to produce ALA and PBG, we explore the impact of reduced availability of energy metabolites in the severity of AIP pathophysiology. Classic studies found clinical improvement in patients affected by AIP associated with the administration of glucose and concomitant insulin secretion, or after hyperinsulinemia associated with diabetes. Molecular studies have confirmed that glucose and insulin administration induces a repressive effect on hepatic ALA Synthase, the first and regulatory step of the heme pathway. More recently, the insulin-mimicking α-lipoic acid has been shown to improve glucose metabolism and mitochondrial dysfunction in a hepatocyte cell line transfected with interfering RNA targeting PBGD. In AIP mice, preventive treatment with an experimental fusion protein of insulin and apolipoprotein A-I improved the disease by promoting fat mobilization in adipose tissue, increasing the metabolite bioavailability for the TCA cycle and inducing mitochondrial biogenesis in the liver. In this review, we analyze the possible mechanisms underlying abnormal hepatocellular carbohydrate homeostasis in AIP.

Protocolo de actuación en pacientes con sospecha de porfiria aguda / Protocol for patients with suspected acute porphyria

Las porfirias son errores congénitos del metabolismo de las porfirinas o ruta biosintética del hemo. El acúmulo de los precursores de las porfirinas, ácido delta aminolevulínico (ALA) y/o porfobilinógeno (PBG) es responsable de las crisis neuroviscerales de las porfirias agudas que cuando se expresan clínicamente se inician con intenso dolor abdominal. Durante las crisis la eliminación urinaria de PBG y ALA siempre es muy elevada. La excesiva concentración de PBG en orina es fácilmente identificable mediante el sencillo test de Hoesch. Un test negativo descarta crisis porfírica actual. El protocolo de actuación en pacientes con dolor abdominal agudo no filiado en los que el test de Hoesch positivo permite la sospecha de porfiria aguda se basa en los siguientes aspectos: valoración clínica inicial en el servicio de urgencias, supresión de los posibles factores desencadenantes, tratamiento específico de la crisis con hemina y/o sobrecarga de glucosa y tratamiento sintomático

Porphyrias are a group of congenital errors in porphyrin metabolism and in the heme biosynthetic pathway. Accumulation of porphyrin precursors (delta-aminolaevulinic acid and porphobilinogen) is responsible for the neurovisceral crises of acute porphyria, which, when expressed clinically, start with intense abdominal pain. During crises, the urinary elimination of porphobilinogen and delta-aminolaevulinic acid is always very high. Excessive porphobilinogen concentration in urine is easily identified using the simple Hoesch test. A negative test rules out a current porphyric crisis. The clinical protocol for patients with acute abdominal pain of unknown origin in whom a positive Hoesch test leads to the suspicion of acute porphyria is based on the following aspects: initial clinical assessment in the emergency department, suppression of potential triggers, specific treatment for the crisis with hemin and/or glucose overload and symptomatic treatment

Phase 3 Trial of RNAi Therapeutic Givosiran for Acute Intermittent Porphyria.

BACKGROUND: Up-regulation of hepatic delta-aminolevulinic acid synthase 1 (ALAS1), with resultant accumulation of delta-aminolevulinic acid (ALA) and porphobilinogen, is central to the pathogenesis of acute attacks and chronic symptoms in acute hepatic porphyria. Givosiran, an RNA interference therapy, inhibits ALAS1 expression. METHODS: In this double-blind, placebo-controlled, phase 3 trial, we randomly assigned symptomatic patients with acute hepatic porphyria to receive either subcutaneous givosiran (2.5 mg per kilogram of body weight) or placebo monthly for 6 months. The primary end point was the annualized rate of composite porphyria attacks among patients with acute intermittent porphyria, the most common subtype of acute hepatic porphyria. (Composite porphyria attacks resulted in hospitalization, an urgent health care visit, or intravenous administration of hemin at home.) Key secondary end points were levels of ALA and porphobilinogen and the annualized attack rate among patients with acute hepatic porphyria, along with hemin use and daily worst pain scores in patients with acute intermittent porphyria. RESULTS: A total of 94 patients underwent randomization (48 in the givosiran group and 46 in the placebo group). Among the 89 patients with acute intermittent porphyria, the mean annualized attack rate was 3.2 in the givosiran group and 12.5 in the placebo group, representing a 74% lower rate in the givosiran group (P<0.001); the results were similar among the 94 patients with acute hepatic porphyria. Among the patients with acute intermittent porphyria, givosiran led to lower levels of urinary ALA and porphobilinogen, fewer days of hemin use, and better daily scores for pain than placebo. Key adverse events that were observed more frequently in the givosiran group were elevations in serum aminotransferase levels, changes in serum creatinine levels and the estimated glomerular filtration rate, and injection-site reactions. CONCLUSIONS: Among patients with acute intermittent porphyria, those who received givosiran had a significantly lower rate of porphyria attacks and better results for multiple other disease manifestations than those who received placebo. The increased efficacy was accompanied by a higher frequency of hepatic and renal adverse events. (Funded by Alnylam Pharmaceuticals; ENVISION ClinicalTrials.gov number, NCT03338816.).

Uncontrolled Acute Intermittent Porphyria as a Cause of Spontaneous Abortion.

INTRODUCTION: The association of acute intermitetn porphyria (AIP) with pregnancy and as a cause of spontaneous abortion is rare. AIM: To show a case of AIP known before pregnancy in a patient who had a spontaneous abortion. CASE REPORT: A gynecologist examined 26-year-old patient in the 8th week of gestation, due to initial spontaneous abortion, abdominal pain, constipation, muscle weakness, vomiting and dark colour of urine. Her therapy was dydrogesterone. In consultation with an anesthesiologist, a short intravenous anesthesia, vacuum aspiration, and curettage were performed.During hospitalization, the patient ceased to take harmful drugs and she was given haemarginate, glucose and symptomatic drugs, and she recovered completely. CONCLUSION: Treatment of threatened spontaneous abortion in AIP remains the subject of dilemma and controversy, and future research is needed.

Acute intermittent porphyria: A case report / [Porfiria intermitente aguda: reporte de caso].

The term 'porphyria' comes from the Greek 'porphyra'. It refers to a heterogeneous group of metabolic disorders caused by the enzymatic deficiency in the biosynthesis of the heme group. Acute intermittent porphyria is caused by a deficiency of the porphobilinogen deaminase enzyme. A 40-year-old woman presented with abdominal pain for ten days (which required laparotomy that evidenced no surgical pathology), severe hydroelectrolytic disorder due to hyponatremia and resistant hypokalemia, persistent tachycardia and hypertension. Seven days later, she developed acute flabby quadriparesis and presented a single generalized tonic-clonic convulsive crisis. Neurophysiological studies supported mixed axonal polyneuropathy and urine results of porphobilinogen and porphyrins were elevated. After acute intermittent porphyria was diagnosed, hemin was administered, which stabilized the patient's clinical signs and normalized the porphobilinogen. The prevalence of this entity is 1 in 2,000 people. It is an autosomal dominant disease, which affects mainly women between 20 and 40 years of age. This entity manifests with neurological and visceral symptoms. Management consists of hematin and dextrose administration avoiding hypotonic solutions because of the risk of exacerbating hyponatremia.

El término 'porfiria' proviene del griego 'porphyra' y alude a un grupo heterogéneo de trastornos metabólicos causados por una deficiencia enzimática en la biosíntesis del grupo hemo. La causa de la porfiria intermitente aguda es la deficiencia de la enzima deaminasa del porfobilinógeno. Se presenta el caso de una mujer de 40 años que presentó dolor abdominal de 10 días de evolución, trastorno hidroelectrolítico grave debido a hiponatremia e hipopotasemia, taquicardia e hipertensión arterial sistémica persistentes, por lo cual fue sometida a una laparotomía en la que no se encontró ninguna afección de origen quirúrgico, A los siete días del examen inicial, la paciente desarrolló cuadriparesia flácida aguda y presentó una crisis convulsiva tónico-clónica generalizada. Los estudios neurofisiológicos evidenciaron una polineuropatía axonal mixta, y los valores de porfobilinógeno y porfirinas en orina eran elevados. Tras diagnosticarse porfiria intermitente aguda, esta se trató con hemina, lo que estabilizó los signos clínicos y normalizó el porfobilinógeno. La prevalencia de esta enfermedad es de 1 en 2.000 personas. Tiene un patrón de herencia autosómico dominante y se manifiesta principalmente en mujeres con edades entre los 20 y los 40 años. La enfermedad cursa con síntomas neurológicos y viscerales, y se trata con la administración de hemina y dextrosa, evitando las soluciones hipotónicas por el riesgo de exacerbar la hiponatremia.

Pharmacokinetics and Pharmacodynamics of the Small Interfering Ribonucleic Acid, Givosiran, in Patients With Acute Hepatic Porphyria.

Givosiran is a small interfering ribonucleic acid agent that was recently approved in the United States for the treatment of acute hepatic porphyria (AHP). This phase I study evaluated the safety, pharmacokinetic, and pharmacodynamic profile of subcutaneously (SC) administered givosiran in patients with acute intermittent porphyria, the most common AHP type. Givosiran was rapidly absorbed from the SC injection site with peak plasma concentrations achieved within 0.5-5 hours followed by elimination with a short half-life of 4-10 hours. Plasma exposures of AS(N-1)3' givosiran, an active metabolite with equal potency as givosiran, was 35%-75%. Givosiran treatment resulted in a rapid and dose-dependent reduction in urinary aminolevulinic acid (ALA) and porphobilinogen (PBG) towards the upper limit of normal (ULN) in AHP patients. Greater and more sustained reductions in ALA and PBG were achieved with once monthly dosing compared with once quarterly dosing. After monthly dosing, trough ALA levels were reduced to below the ULN, approximately 95% reduction from baseline, at both the 2.5 and 5.0 mg/kg doses.

Axonal Polyneuropathy in a Man Treated for Pulmonary Cocci: A Case of Acute Intermittent Porphyria.

BACKGROUND Acute intermittent porphyria (AIP) is a rare autosomal dominant disorder that is part of a group of acute porphyria disorders usually found in females of reproductive age. Although clinically there is low penetrance, with 90% of genetically diagnosed individuals never experiencing an acute flair, consequences of acute flairs may lead to devastating results. Debilitating paresis, seizures, respiratory failure, and even death may result from AIP. Early detection is key in preventing these devastating manifestations. CASE REPORT A 67-year-old Hispanic man with a past medical history of pulmonary Coccidioides on fluconazole presented with bilateral thigh pain for 2 days. At baseline, the patient had no limitations, but now was limited to minimal walking due to his thigh pain subsequently progressing to diffuse weakness after the administration of IV Solumedrol. Over the next few months, EMG was notable for acute-on-chronic sensorimotor axonal denervation in upper and lower extremities, without evidence of myositis. Urine porphobilinogen was 58 mmol/L, which is 29 times the upper limit of normal. Treatment was started with hemin 4 mg/kg/day for 4 days. CONCLUSIONS Over our patient's clinical course, he was affected by a severe manifestation of repeated acute porphyria attacks, which started as anterior thigh pain and progressed to diffused weakness disproportionally affecting the muscles of the upper extremities. Although the patient was in his late 60's at the initial onset of AIP, his diffuse Coccidioides infection, use of azoles, and steroids likely contributed to his first AIP attack.

Acute hepatic porphyrias: Current diagnosis & management.

Each of the four acute hepatic porphyrias is due to mutation of an enzyme in the heme biosynthetic pathway. The accumulation of pathway intermediates that occur most notably when these diseases are active is the basis for screening and establishing a biochemical diagnosis of these rare disorders. Measurement of enzyme activities and especially DNA testing also are important for diagnosis. Suspicion of the diagnosis and specific testing, particularly measurement of urinary porphobilinogen, are often delayed because the symptoms are nonspecific, even when severe. Urinary porphyrins are also measured, but their elevation is much less specific. If porphobilinogen is elevated, second line testing will establish the type of acute porphyria. DNA testing identifies the familial mutation and enables screening of family members. Management includes removal of triggering factors whenever possible. Intravenous hemin is the most effective treatment for acute attacks. Carbohydrate loading is sometimes used for mild attacks. Cyclic attacks, if frequent, can be prevented by a GnRH analogue. Frequent noncyclic attacks are sometime preventable by scheduled (e.g. weekly) hemin infusions. Long term complications may include chronic pain, renal impairment and liver cancer. Other treatments, including RNA interference, are under development.

Clinical Guide and Update on Porphyrias.

Physicians should be aware of porphyrias, which could be responsible for unexplained gastrointestinal, neurologic, or skin disorders. Despite their relative rarity and complexity, most porphyrias can be easily defined and diagnosed. They are caused by well-characterized enzyme defects in the complex heme biosynthetic pathway and are divided into categories of acute vs non-acute or hepatic vs erythropoietic porphyrias. Acute hepatic porphyrias (acute intermittent porphyria, variegate porphyria, hereditary coproporphyria, and aminolevulinic acid dehydratase deficient porphyria) manifest in attacks and are characterized by overproduction of porphyrin precursors, producing often serious abdominal, psychiatric, neurologic, or cardiovascular symptoms. Patients with variegate porphyria and hereditary coproporphyria can present with skin photosensitivity. Diagnosis relies on measurement of increased urinary 5-aminolevulinic acid (in patients with aminolevulinic acid dehydratase deficient porphyria) or increased 5-aminolevulinic acid and porphobilinogen (in patients with other acute porphyrias). Management of attacks requires intensive care, strict avoidance of porphyrinogenic drugs and other precipitating factors, caloric support, and often heme therapy. The non-acute porphyrias are porphyria cutanea tarda, erythropoietic protoporphyria, X-linked protoporphyria, and the rare congenital erythropoietic porphyria. They lead to the accumulation of porphyrins that cause skin photosensitivity and occasionally severe liver damage. Secondary elevated urinary or blood porphyrins can occur in patients without porphyria, for example, in liver diseases, or iron deficiency. Increases in porphyrin precursors and porphyrins are also found in patients with lead intoxication. Patients with porphyria cutanea tarda benefit from iron depletion, hydroxychloroquine therapy, and, if applicable, elimination of the hepatitis C virus. An α-melanocyte-stimulating hormone analogue can reduce sunlight sensitivity in patients with erythropoietic protoporphyria or X-linked protoporphyria. Strategies to address dysregulated or dysfunctional steps within the heme biosynthetic pathway are in development.

High penetrance of acute intermittent porphyria in a Spanish founder mutation population and CYP2D6 genotype as a susceptibility factor.

BACKGROUND: Acute intermittent porphyria (AIP) is a low-penetrant genetic metabolic disease caused by a deficiency of hydroxymethylbilane synthase (HMBS) in the haem biosynthesis. Manifest AIP (MAIP) is considered when carriers develop typical acute neurovisceral attacks with elevation of porphyrin precursors, while the absence of attacks is referred to as latent AIP (LAIP). Attacks are often triggered by drugs, endocrine factors, fasting or stress. Although AIP penetrance is traditionally considered to be around 10-20%, it has been estimated to be below 1% in general population studies and a higher figure has been found in specific AIP populations. Genetic susceptibility factors underlying penetrance are still unknown. Drug-metabolizing cytochrome P450 enzymes (CYP) are polymorphic haem-dependent proteins which play a role in haem demand, so they might modulate the occurrence of AIP attacks. Our aim was to determine the prevalence and penetrance of AIP in our population and analyse the main hepatic CYP genes to assess their association with acute attacks. For this, CYP2C9*2, *3; CYP2C19*2; CYP2D6*4, *5; CYP3A4*1B and CYP3A5*3 defective alleles were genotyped in fifty AIP carriers from the Region of Murcia, a Spanish population with a high frequency of the HMBS founder mutation c.669_698del30. RESULTS: AIP penetrance was 52%, and prevalence was estimated as 17.7 cases/million inhabitants. The frequency of defective CYP2D6 alleles was 3.5 times higher in LAIP than in MAIP. MAIP was less frequent among CYP2D6*4 and *5 carriers (p < 0.05). The urine porphobilinogen (PBG)-to-creatinine ratio was lower in these individuals, although it was associated with a lower prevalence of attacks (p < 0.05) rather than with the CYP2D6 genotype. CONCLUSIONS: AIP prevalence in our region is almost 3 times higher than that estimated for the rest of Spain. The penetrance was high, and similar to other founder mutation AIP populations. This is very relevant for genetic counselling and effective health care. CYP2D6*4 and *5 alleles may be protective factors for acute attacks, and CYP2D6 may constitute a penetrance-modifying gene. Further studies are needed to confirm these findings, which would allow a further progress in clinical risk profile assessment based on the CYP genotype, leading to predictive personalized medicine for each AIP carrier in the future.

Computational disease model of phenobarbital-induced acute attacks in an acute intermittent porphyria mouse model.

INTRODUCTION: Acute intermittent porphyria (AIP) is characterized by hepatic over-production of the heme precursors when aminolevulinic acid (ALA)-synthase 1 is induced by endogenous or environmental factors. The aim of this study was to develop a semi-mechanistic computational model to characterize urine accumulation of heme precursors during acute attacks based on experimental pharmacodynamics data and support the development of new therapeutic strategies. METHODS: Male AIP mice received recurrent phenobarbital challenge starting on days 1, 9, 16 and 30. 24-h urine excretion of ALA, porphobilinogen (PBG) and porphyrins from challenges D1, D9 and D30 constituted the training data set to build the mechanistic model using the population approach. In a second study, porphyrin and porphyrin precursor excretion from challenge D16 were used as a validation data set. RESULTS: The computational model presented the following features: (i) urinary excretion of ALA, PBG and porphyrins was governed by unmeasured circulating heme precursor amounts, (ii) the circulating amounts of ALA and PBG were the precursors of circulating amounts of PBG and porphyrins, respectively, and (iii) the phenobarbital effect linearly increased the synthesis of circulating ALA and PBG levels. The model displayed good parameter precision (coefficient of variation below 32% in all parameters), and adequately described the experimental data. Finally, a theoretical hemin effect was implemented to illustrate the applicability of the model to dosage optimization in drug therapies. CONCLUSIONS: A semi-mechanistic disease model was successfully developed to describe the temporal evolution of urinary heme precursor excretion during recurrent biochemical-induced acute attacks in AIP mice. This model represents the first computational approach to explore and optimize current and new therapies.

Homozygous hydroxymethylbilane synthase knock-in mice provide pathogenic insights into the severe neurological impairments present in human homozygous dominant acute intermittent porphyria.

Acute intermittent porphyria (AIP) is an inborn error of heme biosynthesis due to the deficiency of hydroxymethylbilane synthase (HMBS) activity. Human AIP heterozygotes have episodic acute neurovisceral attacks that typically start after puberty, whereas patients with homozygous dominant AIP (HD-AIP) have early-onset chronic neurological impairment, including ataxia and psychomotor retardation. To investigate the dramatically different manifestations, knock-in mice with human HD-AIP missense mutations c.500G>A (p.Arg167Glu) or c.518_519GC>AG (p.Arg173Glu), designated R167Q or R173Q mice, respectively, were generated and compared with the previously established T1/T2 mice with ~30% residual HMBS activity and the heterozygous AIP phenotype. Homozygous R173Q mice were embryonic lethal, while R167Q homozygous mice (R167Q+/+) had ~5% of normal HMBS activity, constitutively elevated plasma and urinary 5-aminolevulinic acid (ALA) and porphobilinogen (PBG), profound early-onset ataxia, delayed motor development and markedly impaired rotarod performance. Central nervous system (CNS) histology was grossly intact, but CNS myelination was delayed and overall myelin volume was decreased. Heme concentrations in liver and brain were similar to those of T1/T2 mice. Notably, ALA and PBG concentrations in the cerebral spinal fluid and CNS regions were markedly elevated in R167Q+/+ mice compared with T1/T2 mice. When the T1/T2 mice were administered phenobarbital, ALA and PBG markedly accumulated in their liver and plasma, but not in the CNS, indicating that ALA and PBG do not readily cross the blood-brain barrier. Taken together, these studies suggest that the severe HD-AIP neurological phenotype results from decreased myelination and the accumulation of locally produced neurotoxic porphyrin precursors within the CNS.

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family: A case report.

RATIONALE: Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation. PATIENT CONCERNS: A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia. DIAGNOSES: She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome. INTERVENTIONS: The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing. OUTCOMES: A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability. LESSONS: Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.